Review



shrna targeting scramble  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Addgene inc shrna targeting scramble
    Shrna Targeting Scramble, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1060 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shrna targeting scramble/product/Addgene inc
    Average 96 stars, based on 1060 article reviews
    shrna targeting scramble - by Bioz Stars, 2026-05
    96/100 stars

    Images



    Similar Products

    96
    Addgene inc shrna targeting scramble
    Shrna Targeting Scramble, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shrna targeting scramble/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    shrna targeting scramble - by Bioz Stars, 2026-05
    96/100 stars
      Buy from Supplier

    93
    Santa Cruz Biotechnology non targeting scramble sirna
    BC3 and BCBL1 cell lines were treated or not with 10 and 20 μM J2 (HSP27 inhibitor). After 24 h ( A ) the cytotoxic effect of J2 was measured by trypan blue assay. The histograms represent the percentage of cell viability relative to the control. Data are shown as the mean plus S.D. of three experiments. p value * <0.05, as calculated by ANOVA test. B BiP and CHOP expression as evaluated by western blot analysis. Histone H3 (H3) was used as loading control. The histograms represent the densitometric analysis of the ratio of BiP/H3 and CHOP/H3. The data are represented as the mean plus S.D. of three different experiments. p value * <0.05, as calculated by ANOVA test. BC3 and BCBL1 cell lines treated or not with J2 (20 μM) for 4 h were analyzed by western blot for the expression of XBP1s ( C ) and after 24 h of treatment for cleaved PARP (clPARP) ( D ). GAPDH was used as loading control. The histograms represent the densitometric analysis of the ratio of XBP1s /GAPDH and clPARP/GAPDH. The data are represented as the mean plus S.D. of three different experiments. p value * <0.05, as calculated by Student’s t -test. BC3 and BCBL1 cell lines were knocked down for HSP27 (siHSP27) or scramble treated, using <t>siRNA</t> from different companies (Santa Cruz and Dharmacon respectively), for 24 h and the expression of BiP ( E ) and XBP1s was evaluated by western blot analysis while the effect on cell viability was evaluated by trypan blue assay ( F ). Histone H3 (H3) was used as loading control. The histograms represent the densitometric analysis of the ratio of HSP27/H3, BiP/H3 and XBP1s/H3. The data are represented as the mean plus S.D. of three different experiments. p value * <0.05, as calculated by Student’s t -test.
    Non Targeting Scramble Sirna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/non targeting scramble sirna/product/Santa Cruz Biotechnology
    Average 93 stars, based on 1 article reviews
    non targeting scramble sirna - by Bioz Stars, 2026-05
    93/100 stars
      Buy from Supplier

    96
    Addgene inc non targeting scrambled shrna
    Primary hippocampal neurons were infected with AAV-Ng at DIV7 or with AAV-shNg or scrambled <t>shRNA</t> (AAV-shScr) at DIV10 and analyzed at DIV15. (a) Ng protein levels were assessed by Western blot and normalized to GAPDH (upper panel; n = 4). The proportion of Ng-positive neurons was determined by fundingimmunofluorescence using DAPI to identify total cells (lower panel; n = 4). (b) Dendritic length per neuron, quantified for each field of view, increased following Ng expression. (c) Synaptic density was analyzed by co-localization of excitatory (vGluT1/PSD95) and inhibitory (GAD65/Gephyrin) pre- and postsynaptic markers. Data in histograms are total number of synapses per field of view (0.11 mm 2 ). Ng expression increased the number of excitatory and inhibitory synaptic contacts (yellow puncta; n = 52–58 images). (d) The axon initial segment (AIS) was labeled with anti-ankyrin G (AnkG). Total AIS length (left graph; n = 25 neurons per condition) and distances from soma to AIS onset, peak intensity, and distal end (right graph) were quantified using DAPI to locate the soma. Widefield images (a–c) were acquired on a Zeiss Axiovert 200M microscope with 10× (A, B) or 40× (c) objectives; AIS images (d) were obtained using a Zeiss LSM900 confocal microscope with a 63× objective.
    Non Targeting Scrambled Shrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/non targeting scrambled shrna/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    non targeting scrambled shrna - by Bioz Stars, 2026-05
    96/100 stars
      Buy from Supplier

    90
    Santa Cruz Biotechnology non targeting scrambled shrna control
    Primary hippocampal neurons were infected with AAV-Ng at DIV7 or with AAV-shNg or scrambled <t>shRNA</t> (AAV-shScr) at DIV10 and analyzed at DIV15. (a) Ng protein levels were assessed by Western blot and normalized to GAPDH (upper panel; n = 4). The proportion of Ng-positive neurons was determined by fundingimmunofluorescence using DAPI to identify total cells (lower panel; n = 4). (b) Dendritic length per neuron, quantified for each field of view, increased following Ng expression. (c) Synaptic density was analyzed by co-localization of excitatory (vGluT1/PSD95) and inhibitory (GAD65/Gephyrin) pre- and postsynaptic markers. Data in histograms are total number of synapses per field of view (0.11 mm 2 ). Ng expression increased the number of excitatory and inhibitory synaptic contacts (yellow puncta; n = 52–58 images). (d) The axon initial segment (AIS) was labeled with anti-ankyrin G (AnkG). Total AIS length (left graph; n = 25 neurons per condition) and distances from soma to AIS onset, peak intensity, and distal end (right graph) were quantified using DAPI to locate the soma. Widefield images (a–c) were acquired on a Zeiss Axiovert 200M microscope with 10× (A, B) or 40× (c) objectives; AIS images (d) were obtained using a Zeiss LSM900 confocal microscope with a 63× objective.
    Non Targeting Scrambled Shrna Control, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/non targeting scrambled shrna control/product/Santa Cruz Biotechnology
    Average 90 stars, based on 1 article reviews
    non targeting scrambled shrna control - by Bioz Stars, 2026-05
    90/100 stars
      Buy from Supplier

    96
    Santa Cruz Biotechnology non targeting scrambled sirna
    ( A ) Representative western blot analysis of PAR accumulation and PARP-1 expression at 24 hpi with VEEV (MOI 1.0). NSC34 cells were transfected with either PARP1 <t>siRNA</t> (siPARP1; 20 pmol) or scrambled control siRNA (siCon; 20 pmol) 48 hours prior to infection. Pharmacological inhibition was achieved using ABT-888 (PARPi; 20µM) initiated 1 hour prior to infection and maintained throughout the experiment. ( B ) VEEV replication kinetics in NSC34 and diMN cells (MOI 1.0) following PARP-1 manipulation or nicotinamide riboside (NR; 500 µM) supplementation. To maintain effective concentrations, a 250µM NR spike was added to the infectious media at 12 hpi. Viral titers were quantified by plaque assay on Vero cells from supernatants collected between 6 and 48 hpi. Data represent mean ± SEM from at least three independent biological replicates. PARP-1 inhibition (siPARP1 and PARPi) resulted in an approximate one-log increase in viral titers between 12 and 24 hpi. (C–E) Metabolic and viability rescue at 24 hpi. (C) Intracellular NAD + (NAD/NADH-Glo) and (D)ATP levels (Luminescent ATP Detection) were quantified following treatment with siCon, siPARP1, PARPi, or NR as described above. All metabolic values were normalized to the number of viable cells in matched wells on the same plate to account for infection-induced cell loss. (E) Cell viability was assessed via Alamar Blue fluorescence. All values are expressed relative to mean of uninfected Mock controls. Statistical significance was determined by ordinary one-way ANOVA assuming a lognormal distribution; infected-treated groups were compared to the infected-untreated (or siCon) control via Dunnett’s multiple comparisons test. Mock and treatment-only controls are shown for reference. Data represent mean ± SEM., * = P ≤ 0.05, ** = P ≤ 0.01, *** = P ≤ 0.001
    Non Targeting Scrambled Sirna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/non targeting scrambled sirna/product/Santa Cruz Biotechnology
    Average 96 stars, based on 1 article reviews
    non targeting scrambled sirna - by Bioz Stars, 2026-05
    96/100 stars
      Buy from Supplier

    96
    Addgene inc shrna targeting sequence scramble cctaaggttaagtcgccctcg
    ( A ) Representative western blot analysis of PAR accumulation and PARP-1 expression at 24 hpi with VEEV (MOI 1.0). NSC34 cells were transfected with either PARP1 <t>siRNA</t> (siPARP1; 20 pmol) or scrambled control siRNA (siCon; 20 pmol) 48 hours prior to infection. Pharmacological inhibition was achieved using ABT-888 (PARPi; 20µM) initiated 1 hour prior to infection and maintained throughout the experiment. ( B ) VEEV replication kinetics in NSC34 and diMN cells (MOI 1.0) following PARP-1 manipulation or nicotinamide riboside (NR; 500 µM) supplementation. To maintain effective concentrations, a 250µM NR spike was added to the infectious media at 12 hpi. Viral titers were quantified by plaque assay on Vero cells from supernatants collected between 6 and 48 hpi. Data represent mean ± SEM from at least three independent biological replicates. PARP-1 inhibition (siPARP1 and PARPi) resulted in an approximate one-log increase in viral titers between 12 and 24 hpi. (C–E) Metabolic and viability rescue at 24 hpi. (C) Intracellular NAD + (NAD/NADH-Glo) and (D)ATP levels (Luminescent ATP Detection) were quantified following treatment with siCon, siPARP1, PARPi, or NR as described above. All metabolic values were normalized to the number of viable cells in matched wells on the same plate to account for infection-induced cell loss. (E) Cell viability was assessed via Alamar Blue fluorescence. All values are expressed relative to mean of uninfected Mock controls. Statistical significance was determined by ordinary one-way ANOVA assuming a lognormal distribution; infected-treated groups were compared to the infected-untreated (or siCon) control via Dunnett’s multiple comparisons test. Mock and treatment-only controls are shown for reference. Data represent mean ± SEM., * = P ≤ 0.05, ** = P ≤ 0.01, *** = P ≤ 0.001
    Shrna Targeting Sequence Scramble Cctaaggttaagtcgccctcg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shrna targeting sequence scramble cctaaggttaagtcgccctcg/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    shrna targeting sequence scramble cctaaggttaagtcgccctcg - by Bioz Stars, 2026-05
    96/100 stars
      Buy from Supplier

    Image Search Results


    BC3 and BCBL1 cell lines were treated or not with 10 and 20 μM J2 (HSP27 inhibitor). After 24 h ( A ) the cytotoxic effect of J2 was measured by trypan blue assay. The histograms represent the percentage of cell viability relative to the control. Data are shown as the mean plus S.D. of three experiments. p value * <0.05, as calculated by ANOVA test. B BiP and CHOP expression as evaluated by western blot analysis. Histone H3 (H3) was used as loading control. The histograms represent the densitometric analysis of the ratio of BiP/H3 and CHOP/H3. The data are represented as the mean plus S.D. of three different experiments. p value * <0.05, as calculated by ANOVA test. BC3 and BCBL1 cell lines treated or not with J2 (20 μM) for 4 h were analyzed by western blot for the expression of XBP1s ( C ) and after 24 h of treatment for cleaved PARP (clPARP) ( D ). GAPDH was used as loading control. The histograms represent the densitometric analysis of the ratio of XBP1s /GAPDH and clPARP/GAPDH. The data are represented as the mean plus S.D. of three different experiments. p value * <0.05, as calculated by Student’s t -test. BC3 and BCBL1 cell lines were knocked down for HSP27 (siHSP27) or scramble treated, using siRNA from different companies (Santa Cruz and Dharmacon respectively), for 24 h and the expression of BiP ( E ) and XBP1s was evaluated by western blot analysis while the effect on cell viability was evaluated by trypan blue assay ( F ). Histone H3 (H3) was used as loading control. The histograms represent the densitometric analysis of the ratio of HSP27/H3, BiP/H3 and XBP1s/H3. The data are represented as the mean plus S.D. of three different experiments. p value * <0.05, as calculated by Student’s t -test.

    Journal: Cell Death Discovery

    Article Title: Inhibiting HSP27 activates the XBP1s/CerS1 interplay, which triggers DRP1-driven mitophagy, thereby protecting against cell death and promoting the KSHV lytic cycle in primary effusion lymphoma cells

    doi: 10.1038/s41420-026-02979-2

    Figure Lengend Snippet: BC3 and BCBL1 cell lines were treated or not with 10 and 20 μM J2 (HSP27 inhibitor). After 24 h ( A ) the cytotoxic effect of J2 was measured by trypan blue assay. The histograms represent the percentage of cell viability relative to the control. Data are shown as the mean plus S.D. of three experiments. p value * <0.05, as calculated by ANOVA test. B BiP and CHOP expression as evaluated by western blot analysis. Histone H3 (H3) was used as loading control. The histograms represent the densitometric analysis of the ratio of BiP/H3 and CHOP/H3. The data are represented as the mean plus S.D. of three different experiments. p value * <0.05, as calculated by ANOVA test. BC3 and BCBL1 cell lines treated or not with J2 (20 μM) for 4 h were analyzed by western blot for the expression of XBP1s ( C ) and after 24 h of treatment for cleaved PARP (clPARP) ( D ). GAPDH was used as loading control. The histograms represent the densitometric analysis of the ratio of XBP1s /GAPDH and clPARP/GAPDH. The data are represented as the mean plus S.D. of three different experiments. p value * <0.05, as calculated by Student’s t -test. BC3 and BCBL1 cell lines were knocked down for HSP27 (siHSP27) or scramble treated, using siRNA from different companies (Santa Cruz and Dharmacon respectively), for 24 h and the expression of BiP ( E ) and XBP1s was evaluated by western blot analysis while the effect on cell viability was evaluated by trypan blue assay ( F ). Histone H3 (H3) was used as loading control. The histograms represent the densitometric analysis of the ratio of HSP27/H3, BiP/H3 and XBP1s/H3. The data are represented as the mean plus S.D. of three different experiments. p value * <0.05, as calculated by Student’s t -test.

    Article Snippet: For transfection 10 μl of INTERFERin reagent (Polyplus, Illkirch, France; cat. n. 101000016) in combination with 50 pmol of specific small interfering RNA (siRNA duplex) or with non-targeting (scramble) siRNA (Santa Cruz Biotechnology, Inc., Heidelberg, Germany cat. n. sc-29350) were diluted in 200 μl RPMI without serum and antibiotics, incubated for 10 minutes at RT then added to each well.

    Techniques: Control, Expressing, Western Blot

    Primary hippocampal neurons were infected with AAV-Ng at DIV7 or with AAV-shNg or scrambled shRNA (AAV-shScr) at DIV10 and analyzed at DIV15. (a) Ng protein levels were assessed by Western blot and normalized to GAPDH (upper panel; n = 4). The proportion of Ng-positive neurons was determined by fundingimmunofluorescence using DAPI to identify total cells (lower panel; n = 4). (b) Dendritic length per neuron, quantified for each field of view, increased following Ng expression. (c) Synaptic density was analyzed by co-localization of excitatory (vGluT1/PSD95) and inhibitory (GAD65/Gephyrin) pre- and postsynaptic markers. Data in histograms are total number of synapses per field of view (0.11 mm 2 ). Ng expression increased the number of excitatory and inhibitory synaptic contacts (yellow puncta; n = 52–58 images). (d) The axon initial segment (AIS) was labeled with anti-ankyrin G (AnkG). Total AIS length (left graph; n = 25 neurons per condition) and distances from soma to AIS onset, peak intensity, and distal end (right graph) were quantified using DAPI to locate the soma. Widefield images (a–c) were acquired on a Zeiss Axiovert 200M microscope with 10× (A, B) or 40× (c) objectives; AIS images (d) were obtained using a Zeiss LSM900 confocal microscope with a 63× objective.

    Journal: bioRxiv

    Article Title: Neurogranin enhances spontaneous activity and neuronal survival of hippocampal neurons

    doi: 10.64898/2026.01.27.701932

    Figure Lengend Snippet: Primary hippocampal neurons were infected with AAV-Ng at DIV7 or with AAV-shNg or scrambled shRNA (AAV-shScr) at DIV10 and analyzed at DIV15. (a) Ng protein levels were assessed by Western blot and normalized to GAPDH (upper panel; n = 4). The proportion of Ng-positive neurons was determined by fundingimmunofluorescence using DAPI to identify total cells (lower panel; n = 4). (b) Dendritic length per neuron, quantified for each field of view, increased following Ng expression. (c) Synaptic density was analyzed by co-localization of excitatory (vGluT1/PSD95) and inhibitory (GAD65/Gephyrin) pre- and postsynaptic markers. Data in histograms are total number of synapses per field of view (0.11 mm 2 ). Ng expression increased the number of excitatory and inhibitory synaptic contacts (yellow puncta; n = 52–58 images). (d) The axon initial segment (AIS) was labeled with anti-ankyrin G (AnkG). Total AIS length (left graph; n = 25 neurons per condition) and distances from soma to AIS onset, peak intensity, and distal end (right graph) were quantified using DAPI to locate the soma. Widefield images (a–c) were acquired on a Zeiss Axiovert 200M microscope with 10× (A, B) or 40× (c) objectives; AIS images (d) were obtained using a Zeiss LSM900 confocal microscope with a 63× objective.

    Article Snippet: As a control, a non-targeting scrambled shRNA (gtgccaagacgggtagtca, Addgene #181875) was used.

    Techniques: Infection, shRNA, Western Blot, Expressing, Labeling, Microscopy

    ( A ) Representative western blot analysis of PAR accumulation and PARP-1 expression at 24 hpi with VEEV (MOI 1.0). NSC34 cells were transfected with either PARP1 siRNA (siPARP1; 20 pmol) or scrambled control siRNA (siCon; 20 pmol) 48 hours prior to infection. Pharmacological inhibition was achieved using ABT-888 (PARPi; 20µM) initiated 1 hour prior to infection and maintained throughout the experiment. ( B ) VEEV replication kinetics in NSC34 and diMN cells (MOI 1.0) following PARP-1 manipulation or nicotinamide riboside (NR; 500 µM) supplementation. To maintain effective concentrations, a 250µM NR spike was added to the infectious media at 12 hpi. Viral titers were quantified by plaque assay on Vero cells from supernatants collected between 6 and 48 hpi. Data represent mean ± SEM from at least three independent biological replicates. PARP-1 inhibition (siPARP1 and PARPi) resulted in an approximate one-log increase in viral titers between 12 and 24 hpi. (C–E) Metabolic and viability rescue at 24 hpi. (C) Intracellular NAD + (NAD/NADH-Glo) and (D)ATP levels (Luminescent ATP Detection) were quantified following treatment with siCon, siPARP1, PARPi, or NR as described above. All metabolic values were normalized to the number of viable cells in matched wells on the same plate to account for infection-induced cell loss. (E) Cell viability was assessed via Alamar Blue fluorescence. All values are expressed relative to mean of uninfected Mock controls. Statistical significance was determined by ordinary one-way ANOVA assuming a lognormal distribution; infected-treated groups were compared to the infected-untreated (or siCon) control via Dunnett’s multiple comparisons test. Mock and treatment-only controls are shown for reference. Data represent mean ± SEM., * = P ≤ 0.05, ** = P ≤ 0.01, *** = P ≤ 0.001

    Journal: bioRxiv

    Article Title: Encephalitic Alphavirus Infection Induces PARP-1 Hyperactivation Mediated Energy Collapse in Motor Neurons

    doi: 10.64898/2026.01.23.701280

    Figure Lengend Snippet: ( A ) Representative western blot analysis of PAR accumulation and PARP-1 expression at 24 hpi with VEEV (MOI 1.0). NSC34 cells were transfected with either PARP1 siRNA (siPARP1; 20 pmol) or scrambled control siRNA (siCon; 20 pmol) 48 hours prior to infection. Pharmacological inhibition was achieved using ABT-888 (PARPi; 20µM) initiated 1 hour prior to infection and maintained throughout the experiment. ( B ) VEEV replication kinetics in NSC34 and diMN cells (MOI 1.0) following PARP-1 manipulation or nicotinamide riboside (NR; 500 µM) supplementation. To maintain effective concentrations, a 250µM NR spike was added to the infectious media at 12 hpi. Viral titers were quantified by plaque assay on Vero cells from supernatants collected between 6 and 48 hpi. Data represent mean ± SEM from at least three independent biological replicates. PARP-1 inhibition (siPARP1 and PARPi) resulted in an approximate one-log increase in viral titers between 12 and 24 hpi. (C–E) Metabolic and viability rescue at 24 hpi. (C) Intracellular NAD + (NAD/NADH-Glo) and (D)ATP levels (Luminescent ATP Detection) were quantified following treatment with siCon, siPARP1, PARPi, or NR as described above. All metabolic values were normalized to the number of viable cells in matched wells on the same plate to account for infection-induced cell loss. (E) Cell viability was assessed via Alamar Blue fluorescence. All values are expressed relative to mean of uninfected Mock controls. Statistical significance was determined by ordinary one-way ANOVA assuming a lognormal distribution; infected-treated groups were compared to the infected-untreated (or siCon) control via Dunnett’s multiple comparisons test. Mock and treatment-only controls are shown for reference. Data represent mean ± SEM., * = P ≤ 0.05, ** = P ≤ 0.01, *** = P ≤ 0.001

    Article Snippet: A non-targeting scrambled siRNA (Santa Cruz, #sc-37007) served as a control.

    Techniques: Western Blot, Expressing, Transfection, Control, Infection, Inhibition, Plaque Assay, Fluorescence